In vitro activity of milk thistle against cytochrome P450 isozymes

B. C. FOSTER1, C. E. DROUIN2, J. LIVESEY3, J. T. ARNASON3 and E. MILLS4

 

1 Office of Science, Therapeutic Products Directorate, Health Canada, Ottawa, Ontario.

2 Centre for Research in Biopharmaceuticals, University of Ottawa, Ottawa, Ontario.

3 Ottawa-Carleton Institute of Biology, University of Ottawa, Ottawa, Ontario.

 Introduction

Milk thistle is a widely used plant‑based medicine. Orally, milk thistle is used as a liver protectant to lessen damage from potentially hepatotoxic drugs, and for treating liver disorders including toxic liver damage caused by chemicals, Amanita phalloides mushroom poisoning, jaundice, chronic inflammatory liver disease, hepatic cirrhosis, and chronic hepatitis. It is also used orally for loss of appetite, dyspeptic and gallbladder complaints, hangover, and diseases of the spleen. Milk thistle is used orally for prostate cancer, pleurisy, malaria, depression, uterine complaints, stimulating breast milk flow, and stimulating menstrual flow. The applicable parts of milk thistle are the fruit (seed) and above ground parts. The seed is most commonly used medicinally. Silymarin, the active constituent of the milk thistle seed, consists of four flavonolignans called silibinin (silybin), isosilybinin, silichristin (silychristin), and silidianin. Silibinin makes up about 70% of silymarin. When ingested, silymarin undergoes enterohepatic recirculation and has higher concentrations in liver cells. Silymarin is a potent inhibitor of tumor necrosis factor (TNF). The cytotoxicity, inflammation, and apoptosis induced by TNF are effectively blocked by silymarin. Silybin is an antioxidant, a free radical scavenger, and an inhibitor of lipid peroxidation. Several activities seem to contribute to the therapeutic effect of silymarin in liver disease. Silymarin seems to cause an alteration of the outer hepatocyte cell membrane that prevents toxin penetration. It also stimulates nucleolar polymerase A, resulting in increased ribosomal protein synthesis, which can stimulate liver regeneration and the formation of new hepatocytes. There is also some evidence that silymarin might have antifibrotic, anti‑inflammatory, and immunomodulating effects that could also be beneficial in liver disease. Silymarin and silybin inhibit beta‑glucuronidase, which might help protect against hepatic injury and possibly colon cancer. Inhibition of beta‑glucuronidase is thought to reduce the hydrolysis of glucuronides into toxic metabolites in the liver and intestine. Preliminary evidence indicates that milk thistle constituents might protect against kidney damage. In vitro, silibinin and silicristin can protect the kidney cells from nephrotoxic drugs such as acetaminophen, cisplatin, and vincristine. Silibinin and silicristin also appear to have a regenerative effect on kidney cells, similar to the effects on hepatic cells. There is some interest in using milk thistle for prostate cancer. The milk thistle plant above ground parts seem to have some estrogenic activity. A milk thistle plant extract appears to enhance estradiol binding to estrogen receptors, induce transcription activity in estrogen‑responsive cells, and enhance estradiol‑induced transcription activity in estrogen‑responsive cells. There is preliminary evidence that milk thistle might affect drug metabolism. In vitro, silymarin and its flavonolignan, silibinin, inhibit cytochrome P450 2C9 (CYP2C9) and cytochrome P450 3A4 (CYP3A4), the major phase 1 hepatic enzyme, and uridine diphosphoglucuronosyl transferase (UGT), the major phase 2 enzyme that is responsible for glucuronidation.

The therapeutic effects of many herbal medicines have been established; however, definitive pharmacological mechanisms of action remain to be elucidated for many herbal medication which affect the central nervous system. Although several mechanisms have been identified using purified biomarkers, some studies have provided insufficient information to account for the observed effects of the plant or its extracts. This emphasizes the need to consider the additive and supra‑additive effects of the multiple constituents. In addition, components of the plant may act to reduce the potential toxicity of other constituents. Interactions may occur through pharmacokinetic and or pharmacodynamic interactions

This study examined whether commercial milk thistle products (capsules, soft gel capsules, caplets, tablets, a tincture and teas) have an affect on the activity of CYP 3A4-mediated metabolism.

In vitro methods: All products were identified with a Nutraceutical Research Programme (NRP) number and vouchers were stored at the University of Ottawa. Dibenzylfluorescin (DBF) was obtained from BD GENTEST1 (Woburn, USA). The other chemicals and solvents were all analytical grade.

Stock solutions were prepared unless stated otherwise at room temperature under reduced lighting conditions from the plant material within capsules. Capsules were extracted at a concentration of 100 mg/ml, vortexed for 1 min and centrifuged for 13 min at 13,000 rpm. All extracts were protected from light and were not kept for more than a day.

Milk thistle Content Analysis

Each sample was weighed (approximately 0.5 g) and extracted three times in 8 ml of 70 % ethanol using ultrasound for 5 min and then centrifuged at 1000 x g for 5 min. The supernatant was collected after each centrifugation and the final extract volume was adjusted to 25 ml. The extracts were filtered through a (0.22 : PTFE membrane) prior to injection into the High Performance Liquid Chromotography (HPLC) system. Samples were analyzed by HPLC using a 4 :m LiChrospher 100 RP-18, 75 x 4.6 mm analytical column and 5 :m LiChrospher 100 RP-18 guard column (E. Merck, Toronto, Canada) in a Varian Star HPLC system at 225 nm.

Cytochrome P450 Assay Procedure

Aliquots (5 :l) of stock solutions from the extracts were screened for their ability to inhibit 2C19, 3A4, 3A5 and 3A7 marker substrates using an in vitro fluorometric microtiter plate assay. The assays were performed in clear-bottom, opaque-welled microtiter plates (96 well, Corning Costar, model # CS00-3632, Corning, NY). Blank wells consisted of 70% ethanol or acetonitrile, deionized water, NADPH (ß-nicotinamide adenine dinucleotide phosphate, reduced form; Sigma Chemical Co., St-Louis, MO) solution, buffer solution (KH2PO4, pH 7.4 (0.5 M)), DBF and denatured enzyme (boiled). Control wells consisted of 70% ethanol or acetonitrile, deionized water, NADPH, buffer solution, DBF and 3A4 enzyme. Test wells contained milk thistle extract, deionized water, NADPH, buffer solution, DBF and enzyme. The control-test wells consisted of milk thistle extract, deionized water, NADPH, buffer solution, DBF and denatured enzyme. Control-blank wells contained milk thistle extract, deionized water, NADPH, buffer solution and enzyme. The enzyme was thawed in a 37°C sand bath. Solutions containing enzyme that had to be denatured were boiled for 15 min. All solutions were vortexed prior to addition to the wells except the solutions that required preservation of enzymatic activity. These were gently mixed and were sonicated for 2 sec before being added to the wells. The plates were agitated and incubated at 37°C in the plate reader and counted after 20 min.

The wells were prepared in triplicate to ensure the consistency of the results. The mean and coefficient of variation of each triplicate was calculated. Then, the difference between the test and the control-test was divided by the difference between the control and the control-blank. Each assay was repeated at least once. All assays were conducted under a gold fluorescent light to prevent product degradation.

RNA expression

A stock solution was prepared by aqueous extraction of ground material (60 mg /mL). The stock solution was centrifuged to remove solid matter and filter sterilized. The stock was added to the Caco-2 cell cultures in a serial 10-fold dilution with the final concentration of 1x treated cultures being equivalent to 6 mg/mL. Total RNA was extracted from the Caco-2 cells by using the QIAGEN RNeasy Mini kit with RNA stabilizer in accordance with manufacturer’s instructions. The concentration and purity of RNA were quantified spectrophotometrically. The sample was stored –70°C.

Reverse transcription reaction and PCR

Reverse transcription of RNA was done in a final volume of 50 :L by using Ready to go RT-PCR (Amersham Pharmacia Biotech). This was a one-step protocol for RT-PCR with incubation at 42°C for 15-30 min and 95°C for 5 min to inactivate the reverse transcriptase and to completely denature the template. The PCR reactions performed with initial denaturing at 95°C for 3 min then denaturing step at 95°C for 45 sec, annealing at 56°C for 45 sec and polymerization at 72°C for 90 sec followed by a final step at 72°C for 10 min repeated for a total of 40 cycles. The amplified fragments were detected by 1% agarose gel electrophoresis and staining with ethidium bromide (Sigma). Each band was analysed on a Image Station 440CF (Kodak Digital Science, Mandel Scientific Co., Guelph, ON). The specific gene expression was determined semi-quantitatively by calculating the ratio of density value from specific genes expressed in relation to the internal house keeping gene ß-actin (specific gene expression/ß-actin expression). The primers for each gene were according to following: ABCB1 sense, PCR product size: 250 bp 5’ GGAAGCCAATGCCTATGACT 3’: ABCB1 antisense, 5’ CGATGAGCTATC ACAATGGT 3’: ß-actin sense, PCR product size: 392 bp 5’ CATCCTCACCCTGAAGTACC 3’: ß-actin antisense 5’ GGTGAGGATCTTCATGAGGT 3’: CYP3A4 sense, PCR product size: 498 bp 5’ CAAGACCCCTTTGTGGAAAA 3’: CYP3A4 antisense, 5’ TCTGAGCGTTTCATTCACCA 3’.

All assays were performed under gold fluorescent lighting and samples were kept under reduced lighting conditions.

 

Results

Five products containing milk thistle in capsules were tested (Table 4.1.1). There were marked differences in the information provided on the product label and listed ingredient making it difficult to compare relative amounts of milk thistle in each product (Table 4.1.2). Daily dose of the capsules ranged from 2 to 3 units daily. Four of the products were reportedly standardized to 80% silymarin, one was standardized to 70% silymarin.

 

Table 4.1.1 Reference number to product:

 

NRP Product Company Label Price $C EXP. Store Form Received
150 Thisilyn

(std MT extract)

Nature’s Way 200mg*100 46 Feb-04 RT cap 18/07/02
151 Milk Thistle Kare & Hope Inc. 460mg*90 22.49 Nov-04 RT cap 18/07/02
152 Milk Thistle Omega Alpha 500mg*60 22.99 Sep-06 RT cap 18/07/02
153 Silymarin 80

(std MT extract)

Metagenics 70mg*90 21.4 Feb-03 RT cap 18/07/02
154 Milk Thistle Plus Genestra Brands 495mg*60 20.99 May-04 RT cap 18/07/02

 

 

Table 4.1.2. Product information of the milk thistle sample examined in this study. Most products had sufficient label information on use and contraindications, form, unit weight, suggested dose, and other ingredients.

 

NRP Product and ingredient list Suggested Dose
150 200mg of Milk Thistle extract,140mg of 70% silymarin; 306mg capsules, exp. 02/04 One capsule * 3 (918mg)
151 460mg capsules, 80% silymarin, 210mg Milk Thistle standardized extract. 250mg Milk Thistle herb Powder; 456mg capsules, exp. 11/04 One capsule *3 (1380mg)
152 250mg Milk Thistle standardized extract (80% silymarin), Milk Thistle seed 250mg. Cellulose, stearic acid, microcrystaline cellulose and magnesium stearate. 460mg capsules, exp.09/06 One capsule *2 or 3 (920-1380mg)
153 Milk Thistle seed extract 70mg, standardized to 80%, 56mg silymarin; 420mg capsules, exp. 02/03 One capsule *3 (1200mg)
154 100mg Milk Thistle standardized extract (80%), 300mg Milk Thistle, 95mg silymarin; 416mg capsules, exp. 05/04 One capsule *3 (1248mg)

 

Each product was analysed to determine content (Table 4.1.3). Constituent analysis determined the total amount of the silymarins (SMN) present which include individual amounts of : taxifolin (TAN), taxifolin (TAX), silichristin (SCN), silidianin (SDN), silybin A (SBA), silybin B (SBB), and isosilybin (ISB). Although there were similarities in the amounts of the various constituents detected, analysis on the basis of total SMN/unit or total amount of SBA + SBB per gram revealed that there are marked differences in the products tested. Table 4.1.4 displays the inhibition of cytochrome P450’s by Milk Thistle 100mg/ml water extracts. Table 4.1.5 displays the inhibition of cytochrome P450’s by Milk Thistle 3 and 100 mg/ml ethanol extracts. Note 25 and 50 mg/ml extracts had values similar to the 100mg/ml extracts. Table 4.1.6 displays the total expected inhibitory activity of water extracts per capsule. Relative activity to NRP 150 is given in brackets. Finally, Table 4.1.7 displays the cost breakdown summary of each product relative to the amount of purported active ingredient.

 

Table 4.1.3. Constituent Analysis of the Silymarins (SMN), taxifolin (TAN), Taxifolin (TAX), silichristin (SCN), silidianin (SDN), silybin A (SBA), silybin B (SBB), isosilybin (ISB).

 

NRP SMN/ unit

exp.

mg/mg

SMN

found

mg/unit

SMN found

mg/g

%

A+B

mg/g

%

AB

TAX

%

SCN

%

SDN

%

SBA

%

SBB

%

ISB

%

150 140/306

457

134 43595.2 220 50.7 3.3 23.6 5.3 20 30.7 17.3
151 168/456

368

123 27875.5 127 45.5 5.1 26.4 4.4 16.7 29 18.5
152 200/460

435

143 30870.8 173 55.9 2.4 22.7 4 21.9 34.3 14.9
153 56/402

139

41 10172.7 60 61 2.2 20.8 3.5 22.7 37.4 13.5
154 95/416

228

73 17878.1 103 57.5 2.6 21.4 4 22.2 35.8 13.8

 

Table 4.1.4.Inhibition of cytochrome P450’s by Milk Thistle 100mg/ml water extracts, n=1-2 replicates

 

NRP#

3A4

3A5

3A7

2C19

150

70.9±1.4

57.2

74.7±12.0

91.4

151

87.5±5.5

73.6

70.2±13.2

99.3

152

103.9±7.8

87.3

73.1±14.7

102.4

153

8.08±2.8

64.9

76.5±16.7

91.8

154

55.5±3.5

62

74.0±13.5

98.8

 

Table 4.1.5. Inhibition of cytochrome P450’s by Milk Thistle 3 and 100 mg/ml ethanol extracts, n=2 replicates. Note 25 and 50 mg/ml extracts had values similar to the 100mg/ml extracts.

 

NRP#

3A4

3A5

3A7

150

80.7

102.5

72.9

98.5

Nt.

96.5

151

82.4

98.4

78.1

95.2

Nt.

101.8

152

70.7

100.6

62.8

101.7

Nt.

101.5

153

58.3

100.3

48.7

93.8

Nt.

98.6

154

61.9

100.6

45.5

97.1

Nt.

101.4

 

Table 4.1.6. Total expected inhibitory activity of water extracts per capsule. Relative activity to NRP 150 is given in brackets.

 

NRP#

Weight

3A4

3A5

3A7

2C19

150

306 mg

217 (1)

175 (1)

228.6 (1)

279.7 (1)

151

456 mg

399 (1.8)

335.6 (1.9)

333.3 (1.5)

452.8 (1.6)

152

460 mg

478 (2.2)

401.6 (2.3)

336.3 (1.5)

471 (1.7)

153

402 mg

325 (1.5)

260.9 (1.5)

307.5 (1.3)

369 (1.3)

154

416 mg

231 (1.1)

258 (1.5)

307.8 (1.3)

411 (1.5)

Table 4.1.7. Cost breakdown summary of product relative to amount of purported active ingredient.

 

NRP $C Label Unit cost SMN mg/ unit Cost/mg SMN/ unit
150 46 200mg*100 0.46 134 0.0034
151 22.49 460mg*90 0.25 123 0.002
152 22.99 500mg*60 0.383 143 0.0027
153 21.4 70mg*90 0.238 41 0.0058
154 20.99 495mg*60 0.35 73 0.0048

 

Discussion

Inter-individual variability can be further confounded by how the product is prepared and consumed. The results here show that the pharmacologically active constituents within these natural products are not only constituents which may elicit a systemic or pre-systemic effect on drug disposition. The potential risk of a specific product for affecting the safety and efficacy of conventional therapeutic products cannot be determined on the basis of in vitro analysis. Nor can the potential risk be extrapolated to related products until others products and multiple lots have been examined. Some products may contain highly active components which interact with absorption proteins and metabolic enzymes in the gastrointestinal tract and effect a pre-systemic response which mediates disposition of drugs and natural products taken subsequently.

The potential for the natural products examined in this study to affect drug disposition may increase if used in combination with one or more conventional therapeutic products or other natural products. Patients taking other medications or NHPs would be expected to be at a higher risk of experiencing a clinically significant event. Hence, it is necessary to consider the total xenobiotic load of NHPs and pharmaceuticals in order to better predict the potential for interactions. As with garlic2 and St John’s wort3, as the duration of use of these milk thistle products is increased, the potential for an interaction would also be expected to increase.

With the increase in use of herbal medicinal preparations it is becoming increasingly important to elucidate potential adverse effects, including interactions between herbal and conventional drugs. Also, progress needs to be made by manufacturers in assuring their herbal products contain the levels of active ingredients indicated on the product label. This would lead to an increased consumer acceptance of potentially beneficial herbal medications.

 

Contributions to the in vitro study

Ed Mills conceptualized the study, provided funding, acquired the herbal materials and co-wrote the manuscript.

Brian Foster supervised the experiments and co-wrote the manuscript.

C. Drouin and J Livesey conducted the experiments.

J.Thor. Arnason provided expertise in interpreting results.


1. GENTEST. Methodology of a high throughput method for measuring cytochrome P-450 inhibition (version 2). Woburn: GENTEST Technical bulletin, GENTEST Corp. 1998.

2. Piscitelli SC, Burstein AH, Welden N, Gallicano KD, Falloon J. The effect of garlic supplements on the pharmacokinetics of saquinavir. Clin Infect Dis 2002;34:234-8.

3. Piscitelli SC, Burstein AH, Chaitt D, Alfaro RM, Falloon J. Indinavir concentrations and St John’s wort. Lancet 2000;355:547-8.

 

 

Comments are closed.